How to search

HOME> Products> Molecular Biology> Enzyme / Enzyme Inhibitor> DNA Homologous Recombination & Repair Proteins

High-Purity Recombinant Proteins for DNA Replication, Recombination, and Repair Research DNA Homologous Recombination & Repair Proteins

Date：July 08 2026Web Page No：160226

BioAcademia, Inc.

Explore our high-quality recombinant proteins for DNA repair and recombination research. Featuring key factors from both E. coli and mammalian systems (including RecA, Rad51, Rad52, and DNA Polymerases), our products are optimized for high purity and proven functional activity to support your next breakthrough.

＊The products are for research use only.

Features

E. coli Proteins

LexA Repressor

LexA is a repressor protein that recognizes and binds to SOS-box sequences. It suppresses the transcription of genes within the SOS regulon involved in DNA repair and cell division regulation.

RecQ DNA Helicase

RecQ DNA helicase functions during both the early and late stages of homologous recombination. It unwinds DNA structures with specific conformations, such as telomeres and G-quadruplex (G4) DNA.

RuvA / RuvB

RuvA and RuvB form a complex during the late stages of homologous recombination and recombinational repair. This complex specifically binds to the Holliday junction (a recombination intermediate) and promotes branch migration to expand the heteroduplex region.

RuvC

RuvC is a structure-specific endonuclease that acts during the late stages of homologous recombination and recombinational repair. It specifically binds to the Holliday junction, introduces symmetrical nicks at the crossover point, and resolves the junction to release the recombinant DNA molecules.

DNA Photolyase

DNA photolyase is a repair enzyme that monomerizes cyclobutane pyrimidine dimers (CPDs) formed by UV damage. It binds specifically to damaged DNA and catalyzes light-dependent repair using blue light as an energy source.

Mammalian Proteins (Expressed in E. coli)

Rad51 (Human)

Human Rad51 is a functional homolog of E. coli RecA that plays a central role in genetic recombination and repair. It interacts with various proteins, including Rad52 and tumor suppressors like BRCA1 and BRCA2, to maintain genome stability.

Rad52 (Human)

Human Rad52 plays a major role in genetic recombination and repair by mediating strand-annealing reactions between complementary DNA strands. It physically and functionally interacts with Rad51, Dmc1, and RPA during the recombination process.

DNA Polymerase β (Rat)

This is a highly purified, full-length recombinant rat DNA polymerase β. It plays a pivotal role in base excision repair (BER), helping to maintain DNA integrity by filling single-nucleotide gaps.

DNA Polymerase κ (Human)

This is a highly purified recombinant human DNA polymerase κ containing a C-terminal His-tag. It specializes in translesion synthesis (TLS), making it a valuable tool for functional analyses of DNA damage bypass.


Go back to index

Product Information

LexA Repressor

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet. 		01-005 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -80°C CAS
Link

Protein / Enzyme Product List

LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet. 		01-006 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -20°C CAS
Link

Protein / Enzyme Product List

[Date : July 16 2026 00:08]

LexA Repressor, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-005
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -80°C CAS
Link

Protein / Enzyme Product List

LexA Repressor, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-006
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -20°C CAS
Link

Protein / Enzyme Product List



RecQ DNA Helicase

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet. 		01-003 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet. 		01-004 BAKBioAcademia, Inc. 100 µg $1,405

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

[Date : July 16 2026 00:08]

RecQ DNA Helicase, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-003
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

RecQ DNA Helicase, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-004
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,405

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List



RuvA / RuvB

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
RuvA, Recombinant
DatasheetThis may not be the latest data sheet. 		01-007 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvA, Recombinant
DatasheetThis may not be the latest data sheet. 		01-008 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvB, Recombinant
DatasheetThis may not be the latest data sheet. 		01-009 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvB, Recombinant
DatasheetThis may not be the latest data sheet. 		01-010 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

[Date : July 16 2026 00:08]

RuvA, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-007
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvA, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-008
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvB, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-009
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvB, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-010
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List



RuvC

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
RuvC, Recombinant
DatasheetThis may not be the latest data sheet. 		01-011 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvC, Recombinant
DatasheetThis may not be the latest data sheet. 		01-012 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

[Date : July 16 2026 00:08]

RuvC, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-011
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List

RuvC, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-012
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

Protein / Enzyme Product List



DNA Photolyase

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
E. coli DNA Photolyase
DatasheetThis may not be the latest data sheet. 		01-013 BAKBioAcademia, Inc. 20 µg $328

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.4 mg/mL. E. coli DNA photolyase is a DNA repair enzyme that monomerizes cyclobutane pyrimidine dimers (CPDs) formed between adjacent bases in a DNA strand. It binds specifically to UV-damaged DNA and catalyzes light-dependent repair using blue light as an energy source. Purified recombinant full-size E. coli Photolyase (Deoxyribodipyrimidine photolyase). Buffer: 25 mM Tris-HCI (pH 7.4), 50 mM KCl, 0.5 mM EDTA, 5 mM β-mercaptoethanol, 50% Glycerol
Storage -20°C CAS
Link

[Date : July 16 2026 00:08]

E. coli DNA Photolyase

DatasheetThis may not be the latest data sheet.


  • Product Code: 01-013
  • Supplier: BAK
  • Size: 20µg
  • Price: $328

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 0.4 mg/mL. E. coli DNA photolyase is a DNA repair enzyme that monomerizes cyclobutane pyrimidine dimers (CPDs) formed between adjacent bases in a DNA strand. It binds specifically to UV-damaged DNA and catalyzes light-dependent repair using blue light as an energy source. Purified recombinant full-size E. coli Photolyase (Deoxyribodipyrimidine photolyase). Buffer: 25 mM Tris-HCI (pH 7.4), 50 mM KCl, 0.5 mM EDTA, 5 mM β-mercaptoethanol, 50% Glycerol
Storage -20°C CAS
Link



Rad51 (Human)

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
Rad51, Human, Recombinant
DatasheetThis may not be the latest data sheet. 		10-001 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

Rad51, Human, Recombinant
DatasheetThis may not be the latest data sheet. 		10-002 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link

[Date : July 16 2026 00:08]

Rad51, Human, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-001
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

Rad51, Human, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-002
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link



Rad52 (Human)

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet. 		10-003 BAKBioAcademia, Inc. 20 µg $349

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet. 		10-004 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

[Date : July 16 2026 00:08]

Rad52, Human, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-003
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List

Rad52, Human, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-004
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

Protein / Enzyme Product List



DNA Polymerase β (Rat)

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
DNA polymerase β (Rat), functional
DatasheetThis may not be the latest data sheet. 		10-101 BAKBioAcademia, Inc. 20 µg $262

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.3 mg/mL. This is a highly purified, full-length recombinant rat DNA polymerase β expressed in E. coli with high enzymatic activity without any tag attached. It plays a pivotal role in base excision repair (BER), helping to maintain DNA integrity by filling single-nucleotide gaps. The enzyme has molecular mass of 38 kDa. The amino acid sequence of the rat enzyme has 86% identity to the human homolog. Buffer: 50mM Tris-HCl pH7.6, 0.3M KCl, 0.1mM EDTA, 1mM DTT, 20% glycerol.
Storage -80°C CAS
Link

Molecular Biology Product List

DNA polymerase β (Rat), functional
DatasheetThis may not be the latest data sheet. 		10-102 BAKBioAcademia, Inc. 100 µg $790

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.3 mg/mL. This is a highly purified, full-length recombinant rat DNA polymerase β expressed in E. coli with high enzymatic activity without any tag attached. It plays a pivotal role in base excision repair (BER), helping to maintain DNA integrity by filling single-nucleotide gaps. The enzyme has molecular mass of 38 kDa. The amino acid sequence of the rat enzyme has 86% identity to the human homolog. Buffer: 50mM Tris-HCl pH7.6, 0.3M KCl, 0.1mM EDTA, 1mM DTT, 20% glycerol.
Storage CAS
Link

[Date : July 16 2026 00:08]

DNA polymerase β (Rat), functional

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-101
  • Supplier: BAK
  • Size: 20µg
  • Price: $262

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.3 mg/mL. This is a highly purified, full-length recombinant rat DNA polymerase β expressed in E. coli with high enzymatic activity without any tag attached. It plays a pivotal role in base excision repair (BER), helping to maintain DNA integrity by filling single-nucleotide gaps. The enzyme has molecular mass of 38 kDa. The amino acid sequence of the rat enzyme has 86% identity to the human homolog. Buffer: 50mM Tris-HCl pH7.6, 0.3M KCl, 0.1mM EDTA, 1mM DTT, 20% glycerol.
Storage -80°C CAS
Link

Molecular Biology Product List

DNA polymerase β (Rat), functional

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-102
  • Supplier: BAK
  • Size: 100µg
  • Price: $790

Description Purity:＞95%(SDS-PAGE), Host: E. coli, Concentration: 1.3 mg/mL. This is a highly purified, full-length recombinant rat DNA polymerase β expressed in E. coli with high enzymatic activity without any tag attached. It plays a pivotal role in base excision repair (BER), helping to maintain DNA integrity by filling single-nucleotide gaps. The enzyme has molecular mass of 38 kDa. The amino acid sequence of the rat enzyme has 86% identity to the human homolog. Buffer: 50mM Tris-HCl pH7.6, 0.3M KCl, 0.1mM EDTA, 1mM DTT, 20% glycerol.
Storage CAS
Link



DNA Polymerase κ (Human)

[Date : July 16 2026 00:08]

Detail Product Name Product Code Supplier Size Price
DNA Polymerase κ, Functional, Human, Recombinant
DatasheetThis may not be the latest data sheet. 		10-105 BAKBioAcademia, Inc. 50 µg $411

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. This is a highly purified recombinant human DNA polymerase κ(1-560 aa) containing a C-terminal His-tag, expressed in E. coli. It specializes in translesion synthesis (TLS), making it a valuable tool for functional analyses of DNA damage bypass. The product is catalytically active and its molecular weight is 65 kD. Activity of this product has been confirmed by a user researcher even if it was diluted 8,000-fold. Buffer: 50% glycerol, 10 mM sodium phosphate buffer (pH 7.0), 0.2 M NaCl.
Storage -20°C CAS
Link

Molecular Biology Product List

[Date : July 16 2026 00:08]

DNA Polymerase κ, Functional, Human, Recombinant

DatasheetThis may not be the latest data sheet.


  • Product Code: 10-105
  • Supplier: BAK
  • Size: 50µg
  • Price: $411

Description Purity:＞90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. This is a highly purified recombinant human DNA polymerase κ(1-560 aa) containing a C-terminal His-tag, expressed in E. coli. It specializes in translesion synthesis (TLS), making it a valuable tool for functional analyses of DNA damage bypass. The product is catalytically active and its molecular weight is 65 kD. Activity of this product has been confirmed by a user researcher even if it was diluted 8,000-fold. Buffer: 50% glycerol, 10 mM sodium phosphate buffer (pH 7.0), 0.2 M NaCl.
Storage -20°C CAS
Link

Molecular Biology Product List


Go back to index

CONTACT

export@funakoshi.co.jp

  • ※Prices on our website are for your reference only. Please inquire your distributor for your prices.
  • ※Please note that Product Information or Price may change without notice.