HOME> Products> Protein / Enzyme> Protein / Enzyme Product List

Protein / Enzyme Product List

Date:August 28 2014Web Page No:45984

DNA Recombination & Repair

[Date : August 12 2026 00:07]

Detail Product Name Product Code Supplier Size Price
LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet.
01-006 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet.
01-005 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

PCNA (human), functional
DatasheetThis may not be the latest data sheet.
10-152 BAKBioAcademia, Inc. 100 µg $790

Description
Storage -80°C CAS
Link

PCNA (human), functional
DatasheetThis may not be the latest data sheet.
10-151 BAKBioAcademia, Inc. 20 µg $262

Description
Storage -20°C CAS
Link

Rad51, Human, Recombinant
DatasheetThis may not be the latest data sheet.
10-001 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet.
10-004 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet.
10-003 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet.
01-004 BAKBioAcademia, Inc. 100 µg $1,405

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet.
01-003 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvA, Recombinant
DatasheetThis may not be the latest data sheet.
01-007 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvA, Recombinant
DatasheetThis may not be the latest data sheet.
01-008 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvB, Recombinant
DatasheetThis may not be the latest data sheet.
01-009 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvB, Recombinant
DatasheetThis may not be the latest data sheet.
01-010 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvC, Recombinant
DatasheetThis may not be the latest data sheet.
01-011 BAKBioAcademia, Inc. 20 µg $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvC, Recombinant
DatasheetThis may not be the latest data sheet.
01-012 BAKBioAcademia, Inc. 100 µg $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

[Date : August 12 2026 00:07]

LexA Repressor, Recombinant


  • Product Code: 01-006
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

LexA Repressor, Recombinant


  • Product Code: 01-005
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

PCNA (human), functional


  • Product Code: 10-152
  • Supplier: BAK
  • Size: 100µg
  • Price: $790

Description
Storage -80°C CAS
Link

PCNA (human), functional


  • Product Code: 10-151
  • Supplier: BAK
  • Size: 20µg
  • Price: $262

Description
Storage -20°C CAS
Link

Rad51, Human, Recombinant


  • Product Code: 10-001
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

Rad52, Human, Recombinant


  • Product Code: 10-004
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

Rad52, Human, Recombinant


  • Product Code: 10-003
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RecQ DNA Helicase, Recombinant


  • Product Code: 01-004
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,405

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RecQ DNA Helicase, Recombinant


  • Product Code: 01-003
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol.
Storage -80°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvA, Recombinant


  • Product Code: 01-007
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvA, Recombinant


  • Product Code: 01-008
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvB, Recombinant


  • Product Code: 01-009
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvB, Recombinant


  • Product Code: 01-010
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvC, Recombinant


  • Product Code: 01-011
  • Supplier: BAK
  • Size: 20µg
  • Price: $349

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

RuvC, Recombinant


  • Product Code: 01-012
  • Supplier: BAK
  • Size: 100µg
  • Price: $1,053

Description Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol.
Storage -20°C CAS
Link

DNA Homologous Recombination & Repair Proteins

Go back to index

HIV-1 Recombinant Proteins

[Date : August 12 2026 00:07]

Detail Product Name Product Code Supplier Size Price
HIV-1 Reverse Transcriptase, Recombinant
DatasheetThis may not be the latest data sheet.
05-001 BAKBioAcademia, Inc. 200 units $276

Description 10,000-20,000units/ml protein Origin : E.coli Purity : >90%
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1 Reverse Transcriptase, Recombinant
DatasheetThis may not be the latest data sheet.
05-002 BAKBioAcademia, Inc. 1000 units $1,101

Description 10,000-20,000units/ml protein Origin : E.coli Purity : >90%
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p15, Recombinant
DatasheetThis may not be the latest data sheet.
05-008 BAKBioAcademia, Inc. 100 µg $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p15, Recombinant
DatasheetThis may not be the latest data sheet.
05-007 BAKBioAcademia, Inc. 20 µg $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p17, Recombinant
DatasheetThis may not be the latest data sheet.
05-004 BAKBioAcademia, Inc. 100 µg $828

Description Origin : E.coli, Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p17, Recombinant
DatasheetThis may not be the latest data sheet.
05-003 BAKBioAcademia, Inc. 20 µg $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p24, Recombinant
DatasheetThis may not be the latest data sheet.
05-005 BAKBioAcademia, Inc. 20 µg $242

Description Origin : E.coli Purity : >90% (SDS-PAGE), Concentration : 0.65mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p24, Recombinant
DatasheetThis may not be the latest data sheet.
05-006 BAKBioAcademia, Inc. 100 µg $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.65mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p55, Recombinant
DatasheetThis may not be the latest data sheet.
05-010 BAKBioAcademia, Inc. 100 µg $828

Description HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli
Storage -80°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p55, Recombinant
DatasheetThis may not be the latest data sheet.
05-009 BAKBioAcademia, Inc. 20 µg $276

Description HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.44mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Nef, Recombinant
DatasheetThis may not be the latest data sheet.
05-011 BAKBioAcademia, Inc. 20 µg $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Nef, Recombinant
DatasheetThis may not be the latest data sheet.
05-012 BAKBioAcademia, Inc. 100 µg $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

[Date : August 12 2026 00:07]

HIV-1 Reverse Transcriptase, Recombinant


  • Product Code: 05-001
  • Supplier: BAK
  • Size: 200units
  • Price: $276

Description 10,000-20,000units/ml protein Origin : E.coli Purity : >90%
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1 Reverse Transcriptase, Recombinant


  • Product Code: 05-002
  • Supplier: BAK
  • Size: 1000units
  • Price: $1,101

Description 10,000-20,000units/ml protein Origin : E.coli Purity : >90%
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p15, Recombinant


  • Product Code: 05-008
  • Supplier: BAK
  • Size: 100µg
  • Price: $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p15, Recombinant


  • Product Code: 05-007
  • Supplier: BAK
  • Size: 20µg
  • Price: $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p17, Recombinant


  • Product Code: 05-004
  • Supplier: BAK
  • Size: 100µg
  • Price: $828

Description Origin : E.coli, Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p17, Recombinant


  • Product Code: 05-003
  • Supplier: BAK
  • Size: 20µg
  • Price: $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p24, Recombinant


  • Product Code: 05-005
  • Supplier: BAK
  • Size: 20µg
  • Price: $242

Description Origin : E.coli Purity : >90% (SDS-PAGE), Concentration : 0.65mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p24, Recombinant


  • Product Code: 05-006
  • Supplier: BAK
  • Size: 100µg
  • Price: $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.65mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p55, Recombinant


  • Product Code: 05-010
  • Supplier: BAK
  • Size: 100µg
  • Price: $828

Description HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli
Storage -80°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Gag p55, Recombinant


  • Product Code: 05-009
  • Supplier: BAK
  • Size: 20µg
  • Price: $276

Description HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.44mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Nef, Recombinant


  • Product Code: 05-011
  • Supplier: BAK
  • Size: 20µg
  • Price: $242

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

HIV-1, Nef, Recombinant


  • Product Code: 05-012
  • Supplier: BAK
  • Size: 100µg
  • Price: $828

Description Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml
Storage -20°C CAS
Link

HIV-1 Related Recombinant Protein

Go back to index

Protein Labeling Reagents

[Date : August 12 2026 00:07]

Detail Product Name Product Code Supplier Size Price
CloverDirect, AcPhe, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2323 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,914

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633 (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD07 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,491

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633(300μl translation)
DatasheetThis may not be the latest data sheet.
CLD03 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $331

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2008 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, amber(300μl translation)
DatasheetThis may not be the latest data sheet.
CLD1009 PEXPROTEIN EXPRESS Co.,Ltd. 300 µl $387

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2009 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, CGGG (300μl translation)
DatasheetThis may not be the latest data sheet.
CLD1010 PEXPROTEIN EXPRESS Co.,Ltd. 300 µl $387

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF,CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2010 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin (300μl translation)
DatasheetThis may not be the latest data sheet.
CLD04 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $166

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD08 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $746

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2101 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2102 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2103 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-X-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2104 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-XX-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2106 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $870

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, BPA, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2321 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,914

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, amber(300μl translation)
DatasheetThis may not be the latest data sheet.
CLD1001 PEXPROTEIN EXPRESS Co.,Ltd. 300 µl $275

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2001 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2002 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor 488-AF, CGGG(5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2004 PEXPROTEIN EXPRESS Co.,Ltd. 5x300 µl $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor488 (300μl translation)
DatasheetThis may not be the latest data sheet.
CLD01 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor488 (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD05 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,063

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, PEG4-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD2301 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $2,540

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect,TAMRA (300μl translation)
DatasheetThis may not be the latest data sheet.
CLD02 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect,TAMRA (5×300μl translation)
DatasheetThis may not be the latest data sheet.
CLD06 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $1,063

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, TAMRA-X-AF(300μl translation)
CLD1006 PEXPROTEIN EXPRESS Co.,Ltd. 1 kit $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

[Date : August 12 2026 00:07]

CloverDirect, AcPhe, amber (5×300μl translation)


  • Product Code: CLD2323
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,914

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633 (5×300μl translation)


  • Product Code: CLD07
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,491

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633(300μl translation)


  • Product Code: CLD03
  • Supplier: PEX
  • Size: 1kit
  • Price: $331

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO633-AF, CGGG (5×300μl translation)


  • Product Code: CLD2008
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, amber(300μl translation)


  • Product Code: CLD1009
  • Supplier: PEX
  • Size: 300µl
  • Price: $387

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, amber (5×300μl translation)


  • Product Code: CLD2009
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF, CGGG (300μl translation)


  • Product Code: CLD1010
  • Supplier: PEX
  • Size: 300µl
  • Price: $387

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, ATTO655-X-AF,CGGG (5×300μl translation)


  • Product Code: CLD2010
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,740

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin (300μl translation)


  • Product Code: CLD04
  • Supplier: PEX
  • Size: 1kit
  • Price: $166

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin (5×300μl translation)


  • Product Code: CLD08
  • Supplier: PEX
  • Size: 1kit
  • Price: $746

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-AF, amber (5×300μl translation)


  • Product Code: CLD2101
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-AF, CGGG (5×300μl translation)


  • Product Code: CLD2102
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-X-AF, amber (5×300μl translation)


  • Product Code: CLD2103
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-X-AF, CGGG (5×300μl translation)


  • Product Code: CLD2104
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,788

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, Biotin-XX-AF, CGGG (5×300μl translation)


  • Product Code: CLD2106
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $870

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, BPA, amber (5×300μl translation)


  • Product Code: CLD2321
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,914

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, amber(300μl translation)


  • Product Code: CLD1001
  • Supplier: PEX
  • Size: 300µl
  • Price: $275

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, amber (5×300μl translation)


  • Product Code: CLD2001
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, CR110-X-AF, CGGG (5×300μl translation)


  • Product Code: CLD2002
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor 488-AF, CGGG(5×300μl translation)


  • Product Code: CLD2004
  • Supplier: PEX
  • Size: 5x300µl
  • Price: $1,241

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor488 (300μl translation)


  • Product Code: CLD01
  • Supplier: PEX
  • Size: 1kit
  • Price: $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, HiLyte Fluor488 (5×300μl translation)


  • Product Code: CLD05
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,063

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, PEG4-AF, amber (5×300μl translation)


  • Product Code: CLD2301
  • Supplier: PEX
  • Size: 1kit
  • Price: $2,540

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect,TAMRA (300μl translation)


  • Product Code: CLD02
  • Supplier: PEX
  • Size: 1kit
  • Price: $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect,TAMRA (5×300μl translation)


  • Product Code: CLD06
  • Supplier: PEX
  • Size: 1kit
  • Price: $1,063

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

CloverDirect, TAMRA-X-AF(300μl translation)


  • Product Code: CLD1006
  • Supplier: PEX
  • Size: 1kit
  • Price: $235

Description tRNA reagent for Site-Directed Protein Labeling
Storage -80°C CAS
Link

Go back to index

Other Reagents

[Date : August 12 2026 00:07]

Detail Product Name Product Code Supplier Size Price

[Date : August 12 2026 00:07]

Go back to index

CONTACT

export@funakoshi.co.jp

  • Prices on our website are for your reference only. Please inquire your distributor for your prices.
  • Please note that Product Information or Price may change without notice.