Protein / Enzyme Product List
Date:August 28 2014Web Page No:45984
DNA Recombination & Repair
[Date : August 12 2026 00:07]
| Detail | Product Name | Product Code | Supplier | Size | Price | ||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
LexA Repressor, Recombinant DatasheetThis may not be the latest data sheet. |
01-006 | BAKBioAcademia, Inc. | 100 µg | $1,053 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
LexA Repressor, Recombinant DatasheetThis may not be the latest data sheet. |
01-005 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
PCNA (human), functional DatasheetThis may not be the latest data sheet. |
10-152 | BAKBioAcademia, Inc. | 100 µg | $790 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
PCNA (human), functional DatasheetThis may not be the latest data sheet. |
10-151 | BAKBioAcademia, Inc. | 20 µg | $262 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
Rad51, Human, Recombinant DatasheetThis may not be the latest data sheet. |
10-001 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
Rad52, Human, Recombinant DatasheetThis may not be the latest data sheet. |
10-004 | BAKBioAcademia, Inc. | 100 µg | $1,053 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
Rad52, Human, Recombinant DatasheetThis may not be the latest data sheet. |
10-003 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RecQ DNA Helicase, Recombinant DatasheetThis may not be the latest data sheet. |
01-004 | BAKBioAcademia, Inc. | 100 µg | $1,405 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RecQ DNA Helicase, Recombinant DatasheetThis may not be the latest data sheet. |
01-003 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvA, Recombinant DatasheetThis may not be the latest data sheet. |
01-007 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvA, Recombinant DatasheetThis may not be the latest data sheet. |
01-008 | BAKBioAcademia, Inc. | 100 µg | $1,053 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvB, Recombinant DatasheetThis may not be the latest data sheet. |
01-009 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvB, Recombinant DatasheetThis may not be the latest data sheet. |
01-010 | BAKBioAcademia, Inc. | 100 µg | $1,053 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvC, Recombinant DatasheetThis may not be the latest data sheet. |
01-011 | BAKBioAcademia, Inc. | 20 µg | $349 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
RuvC, Recombinant DatasheetThis may not be the latest data sheet. |
01-012 | BAKBioAcademia, Inc. | 100 µg | $1,053 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
[Date : August 12 2026 00:07]
LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-006
- Supplier: BAK
- Size: 100µg
- Price: $1,053
| Description |
Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
LexA Repressor, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-005
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1 mg/mL. Recombinant full-size LexA repressor protein without tag. E. coli LexA repressor protein inhibits the transcription of the genes belonging to the SOS regulon that are related to DNA repair and cell division by recognizing and binding to the SOS-box sequence (TACTGTATATATATACAGTA). LexA repressor‘s self-protease activity is promoted by RecA protein which, responding to DNA damage, is activated by its binding to single-strand DNA accumulated in the cells. It is cleaved into two fragments and loses its function as a repressor. As a result, the expression of genes belonging to the SOS regulon is induced, and DNA repair ability and mutagenic activity in the cells are enhanced. Buffer 50% glycerol, 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 1 mM DTT. |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
PCNA (human), functional
DatasheetThis may not be the latest data sheet.
- Product Code: 10-152
- Supplier: BAK
- Size: 100µg
- Price: $790
| Description | |||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
PCNA (human), functional
DatasheetThis may not be the latest data sheet.
- Product Code: 10-151
- Supplier: BAK
- Size: 20µg
- Price: $262
| Description | |||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link |
|
||
Rad51, Human, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 10-001
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. Human Rad51 protein is a functional and structural homolog of E. coli RecA protein, playing a major role in genetic recombination and recombinational repair by mediating strand-exchange reactions between homologous DNA strands. It physically and functionally interacts with various proteins, including its paralogs, Rad52, and key tumor suppressors such as BRCA1, BRCA2, and P53 to maintain genome stability. This highly purified recombinant protein retains robust nuclear filament-forming capabilities, strand-exchange activity, and ATP-stimulated single-stranded DNA binding activity. Rad51 protein was highly purified from E. coli over-expressing human Rad51 protein as a recombinant protein. The tag was removed from the recombinant protein (it still contains Gly-Ser-His at the N-terminal). Buffer: 20 mM Tris-HCl pH8.0, 100 mM KCl, 1 mM DTT, 0.5 mM EDTA, 10% glycerol. |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 10-004
- Supplier: BAK
- Size: 100µg
- Price: $1,053
| Description |
Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol. |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
Rad52, Human, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 10-003
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>90%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL. The product was highly purified from E. coli over-expressing human Rad52 protein as a recombinant protein. Human Rad52 protein plays a major role in genetic recombination and recombination repair by mediating strand-annealing reaction between complementary DNA strands. Rad52 functionally and physically interacts with Rad51, Dmc1, and RPA in recombination processes. In radiation damaged cells, Rad52 is phosphorylated at Tyr104 by c-Abl tyrosine kinase and forms nuclear foci. Buffer: 20 mM Hepes-KOH, 0.2 M KCl, 0.5 mM EDTA, 1 mM DTT, 10 % Glycerol. |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-004
- Supplier: BAK
- Size: 100µg
- Price: $1,405
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RecQ DNA Helicase, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-003
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 0.45 mg/mL. Recombinant full-length E. coli RecQ protein. E. coli RecQ helicase contributes to the genomic stability as the prototype of RecQ family DNA helicases, mutations of which genes are associated with premature aging and cancer susceptibility, known as Bloom’s and Werner’s syndromes. Buffer: 20 mM Tris-HCl (pH 7.5), 1 mM EDTA, 50 mM KCl, 1 mM DTT, 10 % Glycerol. |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
RuvA, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-007
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RuvA, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-008
- Supplier: BAK
- Size: 100µg
- Price: $1,053
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0-2.7 mg/mL (as determined by BCA method). Recombinant full-length E. coli RecQ protein. The molecular weight of the monomer is 22 kD. E. coli RuvA protein binds specifically to the Holliday structure which is the intermediate of recombination at the late stage of homologous recombination and recombination repair and forms a complex with RuvB motor protein allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. In solution, it forms a tetramer and binds to the cross-like DNA of the Holliday junction from below and above holding it in between. Buffer: 10 mM Tris-HCl (pH 7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-Mercaptoethanol, 50 %Glycerol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RuvB, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-009
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RuvB, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-010
- Supplier: BAK
- Size: 100µg
- Price: $1,053
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Full-length recombinant protein. E. coli RuvB protein forms a complex with RuvA protein at the late stage of homologous recombination and recombination repair and binds specifically to the Holliday structure which is the intermediate of recombination, allowing the migration of Holliday junction using ATP hydrolysis energy and expands the heteroduplex region. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RuvC, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-011
- Supplier: BAK
- Size: 20µg
- Price: $349
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
RuvC, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 01-012
- Supplier: BAK
- Size: 100µg
- Price: $1,053
| Description |
Purity:>95%(SDS-PAGE), Host: E. coli, Concentration: 1.0 mg/mL(as determined by BCA method). Recombinant E. coli full-size RuvC protein without tag. E. coli RuvC protein (19 kDa) is a structurally specific endonuclease which binds specifically to the Holliday structure, an intermediate of recombination, at the late stage of homologous recombination and recombination repair and introduces a nick in the symmetrical point of the Holliday junction cleaving and resolving the recombinant. Buffer: 50% glycerol, 10 mM Tris-HCl (pH7.5), 2 mM EDTA, 100 mM NaCl, 5 mM 2-mercaptoethanol. |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1 Recombinant Proteins
[Date : August 12 2026 00:07]
| Detail | Product Name | Product Code | Supplier | Size | Price | ||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
HIV-1 Reverse Transcriptase, Recombinant DatasheetThis may not be the latest data sheet. |
05-001 | BAKBioAcademia, Inc. | 200 units | $276 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1 Reverse Transcriptase, Recombinant DatasheetThis may not be the latest data sheet. |
05-002 | BAKBioAcademia, Inc. | 1000 units | $1,101 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p15, Recombinant DatasheetThis may not be the latest data sheet. |
05-008 | BAKBioAcademia, Inc. | 100 µg | $828 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p15, Recombinant DatasheetThis may not be the latest data sheet. |
05-007 | BAKBioAcademia, Inc. | 20 µg | $242 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p17, Recombinant DatasheetThis may not be the latest data sheet. |
05-004 | BAKBioAcademia, Inc. | 100 µg | $828 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p17, Recombinant DatasheetThis may not be the latest data sheet. |
05-003 | BAKBioAcademia, Inc. | 20 µg | $242 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p24, Recombinant DatasheetThis may not be the latest data sheet. |
05-005 | BAKBioAcademia, Inc. | 20 µg | $242 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p24, Recombinant DatasheetThis may not be the latest data sheet. |
05-006 | BAKBioAcademia, Inc. | 100 µg | $828 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p55, Recombinant DatasheetThis may not be the latest data sheet. |
05-010 | BAKBioAcademia, Inc. | 100 µg | $828 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Gag p55, Recombinant DatasheetThis may not be the latest data sheet. |
05-009 | BAKBioAcademia, Inc. | 20 µg | $276 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Nef, Recombinant DatasheetThis may not be the latest data sheet. |
05-011 | BAKBioAcademia, Inc. | 20 µg | $242 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
HIV-1, Nef, Recombinant DatasheetThis may not be the latest data sheet. |
05-012 | BAKBioAcademia, Inc. | 100 µg | $828 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
[Date : August 12 2026 00:07]
HIV-1 Reverse Transcriptase, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-001
- Supplier: BAK
- Size: 200units
- Price: $276
| Description |
10,000-20,000units/ml protein Origin : E.coli Purity : >90% |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1 Reverse Transcriptase, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-002
- Supplier: BAK
- Size: 1000units
- Price: $1,101
| Description |
10,000-20,000units/ml protein Origin : E.coli Purity : >90% |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p15, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-008
- Supplier: BAK
- Size: 100µg
- Price: $828
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p15, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-007
- Supplier: BAK
- Size: 20µg
- Price: $242
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.42mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p17, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-004
- Supplier: BAK
- Size: 100µg
- Price: $828
| Description |
Origin : E.coli, Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p17, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-003
- Supplier: BAK
- Size: 20µg
- Price: $242
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.23mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p24, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-005
- Supplier: BAK
- Size: 20µg
- Price: $242
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE), Concentration : 0.65mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p24, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-006
- Supplier: BAK
- Size: 100µg
- Price: $828
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.65mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Gag p55, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-010
- Supplier: BAK
- Size: 100µg
- Price: $828
| Description |
HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link | |||
HIV-1, Gag p55, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-009
- Supplier: BAK
- Size: 20µg
- Price: $276
| Description |
HIV-1 Gag p55 is a precursor protein of several proteins that form the core structure of AIDS virus, which are indispensable to their reproduction. This product is HIV-1 Gag p55 recombinant protein which was over-expressed in E. coli with a plasmid carrying the Gag p55 coding region of HIV-1 virus, subtype B, and highly purified by several steps of chromatography. Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.44mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Nef, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-011
- Supplier: BAK
- Size: 20µg
- Price: $242
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
HIV-1, Nef, Recombinant
DatasheetThis may not be the latest data sheet.
- Product Code: 05-012
- Supplier: BAK
- Size: 100µg
- Price: $828
| Description |
Origin : E.coli Purity : >90% (SDS-PAGE) Concentration : 0.48mg/ml |
||
|---|---|---|---|
| Storage | -20°C | CAS | |
| Link | |||
Protein Labeling Reagents
[Date : August 12 2026 00:07]
| Detail | Product Name | Product Code | Supplier | Size | Price | ||||||||||||||||||||||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
CloverDirect, AcPhe, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2323 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,914 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO633 (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD07 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,491 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO633(300μl translation) DatasheetThis may not be the latest data sheet. |
CLD03 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $331 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO633-AF, CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2008 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,740 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO655-X-AF, amber(300μl translation) DatasheetThis may not be the latest data sheet. |
CLD1009 | PEXPROTEIN EXPRESS Co.,Ltd. | 300 µl | $387 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO655-X-AF, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2009 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,740 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO655-X-AF, CGGG (300μl translation) DatasheetThis may not be the latest data sheet. |
CLD1010 | PEXPROTEIN EXPRESS Co.,Ltd. | 300 µl | $387 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, ATTO655-X-AF,CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2010 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,740 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin (300μl translation) DatasheetThis may not be the latest data sheet. |
CLD04 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $166 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD08 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $746 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin-AF, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2101 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,788 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin-AF, CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2102 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,788 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin-X-AF, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2103 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,788 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin-X-AF, CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2104 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,788 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, Biotin-XX-AF, CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2106 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $870 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, BPA, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2321 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,914 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, CR110-X-AF, amber(300μl translation) DatasheetThis may not be the latest data sheet. |
CLD1001 | PEXPROTEIN EXPRESS Co.,Ltd. | 300 µl | $275 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, CR110-X-AF, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2001 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,241 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, CR110-X-AF, CGGG (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2002 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,241 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, HiLyte Fluor 488-AF, CGGG(5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2004 | PEXPROTEIN EXPRESS Co.,Ltd. | 5x300 µl | $1,241 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, HiLyte Fluor488 (300μl translation) DatasheetThis may not be the latest data sheet. |
CLD01 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $235 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, HiLyte Fluor488 (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD05 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,063 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, PEG4-AF, amber (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD2301 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $2,540 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect,TAMRA (300μl translation) DatasheetThis may not be the latest data sheet. |
CLD02 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $235 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect,TAMRA (5×300μl translation) DatasheetThis may not be the latest data sheet. |
CLD06 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $1,063 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
|
CloverDirect, TAMRA-X-AF(300μl translation) |
CLD1006 | PEXPROTEIN EXPRESS Co.,Ltd. | 1 kit | $235 | |||||||||||||||||||||||||||||||
|
|
|
||||||||||||||||||||||||||||||||||
[Date : August 12 2026 00:07]
CloverDirect, AcPhe, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2323
- Supplier: PEX
- Size: 1kit
- Price: $1,914
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO633 (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD07
- Supplier: PEX
- Size: 1kit
- Price: $1,491
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO633(300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD03
- Supplier: PEX
- Size: 1kit
- Price: $331
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO633-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2008
- Supplier: PEX
- Size: 5x300µl
- Price: $1,740
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO655-X-AF, amber(300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD1009
- Supplier: PEX
- Size: 300µl
- Price: $387
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO655-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2009
- Supplier: PEX
- Size: 5x300µl
- Price: $1,740
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO655-X-AF, CGGG (300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD1010
- Supplier: PEX
- Size: 300µl
- Price: $387
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, ATTO655-X-AF,CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2010
- Supplier: PEX
- Size: 5x300µl
- Price: $1,740
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin (300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD04
- Supplier: PEX
- Size: 1kit
- Price: $166
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD08
- Supplier: PEX
- Size: 1kit
- Price: $746
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2101
- Supplier: PEX
- Size: 1kit
- Price: $1,788
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2102
- Supplier: PEX
- Size: 1kit
- Price: $1,788
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2103
- Supplier: PEX
- Size: 1kit
- Price: $1,788
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin-X-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2104
- Supplier: PEX
- Size: 1kit
- Price: $1,788
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, Biotin-XX-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2106
- Supplier: PEX
- Size: 5x300µl
- Price: $870
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, BPA, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2321
- Supplier: PEX
- Size: 1kit
- Price: $1,914
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, CR110-X-AF, amber(300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD1001
- Supplier: PEX
- Size: 300µl
- Price: $275
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, CR110-X-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2001
- Supplier: PEX
- Size: 5x300µl
- Price: $1,241
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, CR110-X-AF, CGGG (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2002
- Supplier: PEX
- Size: 5x300µl
- Price: $1,241
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, HiLyte Fluor 488-AF, CGGG(5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2004
- Supplier: PEX
- Size: 5x300µl
- Price: $1,241
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, HiLyte Fluor488 (300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD01
- Supplier: PEX
- Size: 1kit
- Price: $235
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, HiLyte Fluor488 (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD05
- Supplier: PEX
- Size: 1kit
- Price: $1,063
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect, PEG4-AF, amber (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD2301
- Supplier: PEX
- Size: 1kit
- Price: $2,540
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect,TAMRA (300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD02
- Supplier: PEX
- Size: 1kit
- Price: $235
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
CloverDirect,TAMRA (5×300μl translation)
DatasheetThis may not be the latest data sheet.
- Product Code: CLD06
- Supplier: PEX
- Size: 1kit
- Price: $1,063
| Description |
tRNA reagent for Site-Directed Protein Labeling |
||
|---|---|---|---|
| Storage | -80°C | CAS | |
| Link |
|
||
Other Reagents
[Date : August 12 2026 00:07]
| Detail | Product Name | Product Code | Supplier | Size | Price |
|---|
[Date : August 12 2026 00:07]
CONTACT
export@funakoshi.co.jp
- ※Prices on our website are for your reference only. Please inquire your distributor for your prices.
- ※Please note that Product Information or Price may change without notice.